• 中文核心期刊
  • CSCD来源期刊
  • 中国科技核心期刊
  • CA、CABI、ZR收录期刊

Message Board

Respected readers, authors and reviewers, you can add comments to this page on any questions about the contribution, review,        editing and publication of this journal. We will give you an answer as soon as possible. Thank you for your support!

Name
E-mail
Phone
Title
Content
Verification Code

2010 Vol. 25, No. 2

Display Method:
Screening mimic epitope of muscovy duck reovirus σC protein with phage-displayed peptide library
WANG Shao, CHEN Shao-ying, LIN Feng-qiang, CHENG Xiao-xia, ZHU Xiao-li, CHEN Shi-long, OUYANG Sui-dong
2010, 25(2): 127-130.
Abstract:
The prokaryotic expression protein(pGEX-4T-1-σC)of Muscovy duck reovirus (MDRV) MW9710 strain was targeted for the screening by using a random bacteriophage 7-mers peptide library. Sequence of the single strand DNA of the phage-displayed peptide was determined and analyzed after four rounds of screening. The results showed that the DNA sequence of the positive peptide was CATCCTATTCATCCGCGTCAT,the corresponding peptide sequence was HPFYSCY,and the positive peptide was similar to a fragment,-P-YS--,located on N-terminal of MDRV-σC. It was thus postulated that the mimic antigen epitope of MDRV-σC was a conformational epitope with a discontinuous amino acid fragment. From the Genbank,this conformational epitope was also found in the peptide sequence of Pre-B cell colony-enhancing factor (PBEF).It appeared that using the phage-displayed peptide library to analyze structure of antigen epitopes could be a useful means.The results obtained from this study provided valuable information for our further study of the conformation and function of the MDRV proteins.
Pathogenic detection and identification of swine respiratory syndrome
YE Yao-hui, WU Nan-yang, HUANG Mei-qing, ZHENG Min, LEI Song-bo, ZHANG Shi-zhong
2010, 25(2): 131-134.
Abstract:
The study detected various kinds of pathogens in pigs suffering from respiratory syndrome by PCR technique and immunofluorescent test. The RT-PCR results showed that the tissue samples of lung and lymph nodes from diseased pigs were positive for PRRSV variant but negative for PRV,CSFV,PCV2 or SIV. A virus strains were also isolated from positive samples by inoculating it onto Marc-145. The 30 days-old piglets inoculated with the isolates showed the same symptoms as appeared naturally on the diseased pigs in the clinic. The virus was recovered from and the interstitial Pneumonia observed in the diseased pigs. Thus,it was concluded that the respiratory disease outbreak in the swine farm was caused by a PRRSV variant.
Study on fat deposit in Hetian chickens
LI Zhong-rong, LIU Jing, YE Ding-cheng, FENG Yu-lan
2010, 25(2): 135-141.
Abstract:
The experiment was carried out to measure weekly the body fat and serum lipids content of Hetian chickens (female from 1w to 16 w and male from 1 w to 14 w). The serum lipids indices,including triglyceride (TG),total cholesterol (TC),high density lipoprotein-cholesterol (HDL-C) and low density lipoprotein-cholesterol (LDL-C),as well as the body fat indices,including abdominal fat percentage (PAF),subcutaneous fat ply (SFP) and intermuscular fat (IeMF),were measured. The results showed that:(1) PAF fluctuated during the testing period, except an increase in the female chickens observed after 10 week (P > 0.05);(2) SFP was significantly low-er in the 1-week-old than older chickens (P P > 0.05), except a significant increase found among the females after 10w and the males after 9w (P P P > 0.05) but a significant increase after that (P P P P P > 0.05) but a high correlation existed among the indices (P P > 0.05);and (6) the body fat content correlated with age or chickens body weight (P < 0.05), which provided a mean of body fat content estimation by using the reg ression equation.
Growth and competitiveness of Microcystis aeruginosa and Chlorella vulgaris at varying pH
XUE Ling-zhan, HUANG Zhong-chi, LIN Ze, HUANG Liu-ting, LIN Xue-wen, WU Mei-ying
2010, 25(2): 142-148.
Abstract:
Uni-culture and co-culture experiments on Microcystis aeruginosa and Chlorella vulgaris were carried out at pH=5,6,7,8,9,10 and 11 under controlled laboratory conditions.The effects of pH on growth and competitiveness of these two algal species were studied.The growth and competing characteristics of M.aeruginosa and C.vulgaris were analyzed using the logistic equation and the Lotka-Volterra model. The results showed that the effects of pH on growth and competitiveness of the two algae were significant; M.aeruginosa grew better when pH=8-11,with an optimal pH of 9; and C.vulgaris grew quickly when pH=7-9,with an optimal pH of 8. In the co-culture experiments,M.aeruginosa had a competitive edge over C.vulgaris,with a β value higher than α at pH=8,9 or 10. However,at pH=7,C.vulgaris gained the upper-hand,with the α value higher than β.
Effect of feeding on different stages of Bemisia tabaci(Gennadius) on development of Delphastus catalinae(Horn)
LUO Hong-wei, WANG Zhu-hong, WANG Lian-de, HUANG Jian
2010, 25(2): 149-152.
Abstract:
Respectively provided the eggs,nymphs and adults of Bemisia tabaci (Gennadius) for rearing of Delphastus catalinae (Horn),the results showed that the eggs of B. tabaci are the most favor food for rearing of D.catalinae. Feeding on the different stages of B. tabaci affected the development of D. catalinae. After preyed the whitefly egg,D. catalinae develops quickly (duration of larva to adult emergence as 19.18d),with high survival rate (survival rate of larva to adult emergence as 78.57%),high oviposition (131.25 eggs/female) and fast population increase (rm=0.0724). The whitefly egg is the best food for artificial rearing of D. catalinae.
Occurrence, distribution and spreading of imported red fire ant(Solenopsis invicta Buren) in Xinluo district, Longyan, Fujian
ZHANG Shuang-hong
2010, 25(2): 153-157.
Abstract:
The imported red fire ant (IRFA),Solenopsis invicta Buren,is a notorious,dangerous invader species in the world. An investigation was carried out on IRFA in Dachi Town,Xinluo District,Longyan,Fujian. The study included the invader's origins,occurrence,distribution,hazard-spreading,infested habitats and colony density,as well as size of their mounds. Survey results showed that IRFA was initially from a local plastics recycling factory. Five years ago,the factory purchased waste plastic bags from Guangdong that brought IRFA into the region. The ants spread 53-297 m in diameter from the quarantined area. The distribution of IRFA was affected by factors,such as sunlight,degree of human disturbance and habitat types.
Effects of absorbent in ploughed furrow on potato productivity and moisture retention in soil of loess hilly and gully regions in southern Fujian
LING Yong-sheng, LI Jin-quan, YE LI-jiao, ZENG Xue-Lian, LI Rui-nan
2010, 25(2): 158-162.
Abstract:
A study was conducted in the loess hilly and gully regions in the southern Fujian to compare the effects of absorbent in ploughed furrow on the potato productivity and soil moisture content. The results showed that the application of a moisture retention agent significantly prolonged the potato growing period by 5 to 10d,as compared to the control. During the budding and harvesting stages,increasing amounts of the absorbent increased the biomass,tuber yield and size of the largest tuber,with fewer tubers.The moisture contents in the tuber-and-root-forming layers of the treated soil were slightly higher before the budding stage,but slightly lower when the leaves and stems began to wither,than those in the control. For a maximized potato production,the absorbent application at a rate of 60 kghm-2 was recommended for the ploughed furrow around the seed potatoes.With the application,the increase on net income was 3477.0 yuanhm-2 with a cost/return ratio of 1/2.93.
Fermentation of cassava flour for fuel alcohol
ZHANG Shu-he, LI Hai-ming, WU Song-hai, LIN Yi-xing
2010, 25(2): 163-166.
Abstract:
The liquefying,sugar-forming,fermenting and other phases of ethanol fermentation using cassava flour were studied. High temperature resistant α-amylase,glucoamylase and Saccharomyces cerevisiae were applied. The data collected were analyzed and calculated by using Excel.The results showed that (a) pH and time had a significant effect on the rate of cassava flour liquefaction (P0.05),but raw materials/water ratio showed no effect (P0.05); (b) the sugar-forming time had a great effect on the amount of reducing sugars (P0.05); (c) the fermentation process was the best with an addition of 0.5% ammonia sulfate yielding an alcohol content of 10.81% (v/v) after 3 days,which was 4.98 times greater than without any nitrogen addition; and,(d) the alcohol produced from the starch amounted to 51.88% by the fermentation.
Selection of a late-ripening, high quality orange, "Murcott"
YU Ya-bai, LIN Bing, WANG Qi, CHEN Yuan, LAI Cheng-chun, XIE Hong-gen
2010, 25(2): 167-169.
Abstract:
"Murcott," a late-ripening and high quality orange variety,was originated from the citrus varieties found in Taiwan. Its ripening time was between February and March. The fruit was oblate in shape with an average fruit mass of 188.3 g. The peel was salmon pink,smooth,tight and thin,with a thickness of 2.36 mm. The fruit flesh was salmon pink,tender and very sweet. Its average soluble solid content was 16.6%,total sugar 12.9% and total acid 0.59%. The average number of seeds was 16,and the edible portion reached 81.7%. The fruit had a good shelf life as well-i.e.,the rate of good fruits neared 100% with an average soluble solid content of 16.6% after 102 days in cold storage.
Phylogeny of Cucurbita Based on ITS sequence data
WU Yu-fen, ZHOU Xian-zhi, CHEN Sheng, CHEN Yang, ZHAO Yi-jie
2010, 25(2): 170-175.
Abstract:
The relationships and differences among the species,Cucurbita,pepo and ficifofia (Cucurbitaceae:Cucurbita),were examined using data from the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA. The ITS sequences were obtained from Cucurbita,pepo and ficifofia 3 species. The results showed that,within Cucurbita,ITS1 was 188-191bp (C. Cucurbita,C. pepo and C. ficifofia) and ITS2 ranged from 251-263bp (C. Cucurbita,C. pepo and C. ficifofia). There were 33 variable positions (17.55%) and 24 informative sites (12.77%) within Cucurbita found in the ITS1 sequences,while 45 variable positions (17.93%) and 31 informative sites (12.35%) found in the ITS2 sequences.The G+C content of ITS1 was 51.60% to 54.50% and that of ITS2 ranged from 53.78% to 56.98%.The resulting trees from the ITS1 and ITS2 sequences showed that the relationship between C. Cucurbita and C. pepo was closer than that between C. Cucurbita and C. ficifofia.
Optimization of culture medium and conditions for adventitious bud proliferation of papaya, "Zhanghong"
CHEN Han-xin, KANG Yue-hui, ZHANG Chao-kun, ZHANG Lian-shui, WAN Xue-feng
2010, 25(2): 176-178.
Abstract:
Factors affecting the multiplication of the new papaya variety,"Zhanghong",in tissue culture were studied. The orthogonal analysis indicated that,among the four factors investigated,BA and KT exerted the greatest effect on the stem growth,followed by sucrose and NAA. Result from the single factor experiments showed that the optimal media for the culture multiplication was MS+0.6% BA+0.2% KT+0.15% NAA+4% sucrose,the temperature was 25℃,and the illumination was 2000 lx.
Heterosis study on 4x Mt CMS and its maintainer line of non-heading chinese cabbage
KONG Yan-e, ZHANG Shu-ning, LI Jun-xing, LIU Hui-ji
2010, 25(2): 179-182.
Abstract:
Six crossing combinations were obtained by using 4x MtCMS line and 6 inbred lines of non-heading Chinese cabbage. Agronomic traits and heterosis of the F1 hybrids were studied. The result indicated that the main agronomic traits had a significant heterosis in the hybrid of non-heading Chinese cabbage. Yield per plant of 6 F1 hybrids had a certain degree of positive mid-parents and over-standard heterosis. Two of the hybrids,namely 4x Mt CMS?07P-10 and 4x Mt CMS?07P-8,were the largest. The mid-parents,over-parents and over-standard heterosis showed 18.90%,15.27% and 12.61%,respectively,in yield per plant. The 6 F1 hybrids were taller,the plant diameter larger,leaves thicker,leaf area larger and yield of plot greater than their parents,and these differences were significant. Quality was improved over their parents,and the mid-parents heterosis was positive but in minute amounts. The heterosis of the over-parents and over-standard were not significant.
Comprehensive evaluation on heat tolerance of various Chinese cabbage seedlings
ZENG Xiao-ling, FANG Shu-gui, CHEN Wen-hui, ZHONG Kai-qin, LIN He-fei
2010, 25(2): 183-186.
Abstract:
At high temperature in a chamber under artificially controlled conditions,5 inbred lines and 4 F1 hybrids of Chinese cabbages at their seedling stage were studied for their heat tolerance. The factor analysis,subordinate function and cluster analysis were applied to evaluate the tested accessions based on the physiological and biochemical indices. The result obtained from the factor analysis indicated that the 8 indices could be characterized as 3 prinipal components,which gave an accumulative contribution rate up to 0.921. A comprehensive evaluation on the heat tolerance was performed based on the D value of subordinate function analysis. The cluster analysis classified the 9 accessions into 3 categories:(1) the highest heat tolerance accessions that included Xiaxiu-1,Xiafu-2 and Xiayou-1,(2) the intermediate accessions that included Zaoshu-5,Bai-yang,Zao5-1 and Zaoza-5,and (3) the sensitive-to-heat-stress accessions that included 020w-8 and Deyang.
Agronomic traits and heat tolerance of diploid and tetraploid petunia
WEI Yue, LI Zhen-lu, CHEN Xiao-yin, WANG Yong-ping, DAI Jin-ping, ZHANG Shu-ning
2010, 25(2): 187-191.
Abstract:
Agronomic traits of diploid and tetraploid petunias (Petunia hybrida Vilm.) were compared under summer heat in the field. Their physiological characteristics of tolerance to heat stress were studied at 42℃/25℃ (day/night) for 10 days in a diurnal growth incubator. The apparent morphological differences between diploid and tetraploid observed included:(a) the tetraploid plant grew more vigorously; (b) its stem became bigger in diameter; (c) its leaves were denser,thicker,larger and darker green in color; (c) the corolla,calyx,stigma and anther grew larger; and (d) its style and pedicel became longer than the diploid petunias. Under the controlled heat stress,the tetraploid leaves had a lower electrolyte leakage rate and content of malondialdehyde (MDA),but higher contents of soluble sugar,total chlorophyll,proline and SOD activity than in diploid leaves. The results from both the field and the artificially controlled chamber demonstrated that the tetraploid petunia had a higher heat tolerance than its diploid counterpart.
Effects of maleic hydrazide on endogenous hormone contents in Longan seeds
LIU Guo-qiang, XIAO Xiang-xi, QIU Dong-liang, XU Wei-dong
2010, 25(2): 192-196.
Abstract:
Maleic hydrazide(MH) was sprayed on a normal longan cultivar (Dimorcarpus longana Lour. cv. Wulongling) to induce the formation of shriveled seeds in longan. The results showed that the contents of gibberellin (GA3),indole-3-acetic acid (IAA) and abscissic acid (ABA) in the shriveled seeds decreased most of the time during fruit development,and the GA3 content reached the minimum at maturation. There was a significant reverse correlation between the formation of the shriveled seeds and the fruit's endogenous hormone content. During seed development,the ratios of ABA/GA3 and ABA/IAA in the seedless fruits were remarkably higher than the control. It was,therefore,concluded that the main reason of the normal longan seeds to become shriveled was due to a reduction of these endogenous hormones.
Total carotenoids in Murcott
GAO Hui-ying, WANG Qi, CHEN Yuan, XIE Hong-gen, LAI Cheng-chun, YU Ya-bai
2010, 25(2): 197-200.
Abstract:
Carotenoids in the peels of Murcott and other 6 citrus fruits were analyzed. The experiment included the effects of solvent and time on the extraction. A fast,accurate,simple and convenient method was developed for the total carotenoids determination. The optimal extraction process used petroleum ether and acetone (1:1,v/v) as the solvent to extract for 3 times. The carotenoids in Murcott peels were significantly higher than those from the other species. The carotenoids concentration was up to (68.09?0.29) mghg-1,which was 6.37 times greater than the lowest,or 2.81 times greater than the average. The carotenoids content in the edible portions of Murcott was (4.49?0.03) mghg-1,which was significantly higher than the others as well. It was 9.55 times greater than the lowest,or 2.27 times greater than the average.
Inflorescence trait diversity of Longan germplasm
HUANG Ai-ping, CHENG Xiu-ping, ZHENG Shao-quan, DENG Chao-jun, HU Wen-shun, ZHANG Xi-juan, LUO Jian-fu, CHEN Xiu-mei, XU Qi-zhi
2010, 25(2): 201-206.
Abstract:
The inflorescence traits of 71 longan germplasms in the National Field Genebank for Longan in Fuzhou were studied. The result showed that (1) the inflorescence was 19.9-39.4 cm long and 14.0-33.0 cm wide with 4.4-13.3 secondary peduncles and 7.1-8.8 stamens in the male flower; (2) the variation coefficient of these five quartified characteristics ranged from 4.9% to 20.0%; (3) the length of the inflorescence was significantly correlated with the width or number of the axis; (4) the inflorescence width was significantly correlated with the number of axis; (5) each of the five characteristics had five different levels with rather different ratios among them; (6) the inflorescence length and width of the germplasms from different area varied greatly the length of the inflorescence of the germplasm from Guangdong was significantly longer than that from Fujian,and the corolla diameter of the germplasm from Fujian was significantly bigger than that from Guangdong; and (7) there were differences on the inflorescence of these longan germplasms in regard to the density of flower cluster,stigma shape,color of flower axis and color of flower bud as well the majority of the inflorescences (i.e.,50.7%) had an "r" shaped stigma,the fork-shaped the least; the majority of the inflorescence had reddish-brown axis (i.e.,60.6%),the green-colored the least; and the greatest majority of buds were light green in color (i.e.,81.7%).
Organ tissue culture of Lilium formolongi
ZHONG Hai-feng, HUANG Yu-xiang, ZHONG Huai-qin, YE Xiu-xian, HUANG Min-ling
2010, 25(2): 207-211.
Abstract:
The floral organ culture and rapid propagation of Lilium formolongi was studied by using its pedicel,receptacle,petal,filament and style for explants. The results showed that (a) adventitious buds could be induced directly from all of the 5 floral organs; (b) the appropriate medium was formulated with MS+2.0 mg 6-BAL-1+0.2 mg NAAL-1; (c) the order of inducing ability of the organs was:receptaclepedicelfilamentpetal or style; (d) the optimum medium formulation for adventitious buds proliferation was:MS+2.0 mg 6-BAL-1+1.0mg KTL-1+0.2 mg NAAL-1; (e) the appropriate medium for in vitro root and bulb formations was:1/2MS+0.03 mg NAAL-1; and (f) the most efficient and low-cost medium for transplantation was:1/4 (v/V) garden mould+1/4 (v/V) peat mould+1/2 (v/V) sawdust.
Technology system of culture for asparagus officiralis L. anther
LIN Zong-keng, WEN Qing-fang, LIN Yi-zhang
2010, 25(2): 212-216.
Abstract:
Experiments were conducted to study the callus inducement and green shoot differentiation of the anther of the breed "Gijnlim",Asparagus officinalis L. The results showed that the optimum asparagus callus induction could be obtained by inoculation on a 1/2 MS culture medium containing 2.0 mg NAAL-1,1.0 mg 6-BAL-1and 6% sucrose after storage at 4℃ for 5-7 days. Moreover,a higher induction rate could be accomplished with a 32℃ incubation for 5 days following the inoculation. Supplementation with 300 mg hydrolyzed caseinL-1in the MS medium also benefited the callus induction. Callus type and age affected the regeneration rate. The regeneration rate of the callus of the dense form was higher than that of the loose form. On the different callus ages (i.e.,10-50 days),30-to 40-day-olds had the highest green shoots regeneration rate. The microscopic examination showed that,among the green shoots from the loose callus,5.7% of the plants were haploids,65.1% diploids,11.9% tetraploids and 17.3% aneuploids; while among the green shoots from the dense callus,28.4% were haploids,45.3% diploids,9.6% tetraploids and 16.7% aneuploids; and,the haploids from the dense callus were more than those from the loose callus.
Proliferation and maturation of somatic embryos of slash pine
WU Li-jun
2010, 25(2): 217-221.
Abstract:
Embryogenic suspensor mass (ESM) of slash pine was induced with the non-mature zygotic embryos as explants. The maintenance,proliferation and maturation of ESM culture were studied with medium optimization. The results indicated that (a) the basic medium in combination of plant growth regulation (PGR) agents affected the proliferation rate and the quality of somatic embryos (SEs); (b) the optimized medium contained DCR+1.0 mg NAAL-1+0.32 mg 6-BAL-1+0.30 mg KTL-1; (c) in medium without PGR,the pretreatment was necessary for the development and maturation of SEs of the slash pine; (d) the combination of ABA,PEG,AC and a high concentration of sucrose improved the maturation of SEs; and (e) the SEs developed into stage 5 on medium of LP+50 mg ABAL-1+20% PEG6000+6% sucrose+2.5 g ACL-1,but no mature embryo was obtained.
Design and implementation of a web-based pesticide information management system
CHI Mei-xiang, QIU Rong-zhou, ZHAO Jian, WANG Chang-fang, WENG Qi-yong
2010, 25(2): 222-225.
Abstract:
This paper describes the design and implementation of a pesticide information management system.Based on the database,network and Web service technologies,this system was designed for pesticide formulation and data management using XML and SOAP standards.
Recent advances in research on endophytes
HU Gui-ping, ZHEN Xue-fang, YOU Min-sheng, LIU Bo
2010, 25(2): 226-234.
Abstract:
In recent years,the biological characteristics,kinetic factors and community ecology of endophytes have become the popular topics for bio-research. With the extension of the field of study and development of new methodologies,endophytic research has reached the areas of biological prevention and medical applications. This article describes the discovery and definition of endophytes,and discusses the future development and existing problems of endophytic research from the viewpoints of biodiversity,dynamics,research methodology,as well as the agricultural and medical applications.
Eradication and immunity evaluation on classic swine fever for pig farms of different sizes
XIU Jin-sheng, WU Shun-yi, ZHOU Lun-jiang, YE Yao-hui, YU Dao-jin, CHEN Ru-jing, WANG Long-bai, ZHANG Xin-liang
2010, 25(2): 235-238.
Abstract:
To evaluate the status of the breeding pigs'immunity against classic swine fever virus (CSFV),serum samples from 10 pig farms of different sizes in Fujian were collected and tested with HerdChek CSFV-ELISA kit. The results showed that the average passing rate (i.e.,antibody blocking rate≥50%) of the pigs with sufficient antibody against CSFV on the 10 farms was 88.11%. The average unqualified (i.e.,blocking rate50%) rate was 11.89%,ranging from 5.36% to 28.63%. A booster vaccination with active vaccine was implemented on the breeding swine that failed the test. Four weeks after the vaccination,a similar test was conducted again. It showed the average passing rate had reached 91.44%,i.e.,an increase of 3.33% over the rate prior to the booster vaccination. Based on the results,some preliminary measures for the CSFV eradication program is presented.