Screening mimic epitope of muscovy duck reovirus σC protein with phage-displayed peptide library

The prokaryotic expression protein(pGEX-4T-1-σC)of Muscovy duck reovirus (MDRV) MW9710 strain was targeted for the screening by using a random bacteriophage 7-mers peptide library. Sequence of the single strand DNA of the phage-displayed peptide was determined and analyzed after four rounds of screening. The results showed that the DNA sequence of the positive peptide was CATCCTATTCATCCGCGTCAT,the corresponding peptide sequence was HPFYSCY,and the positive peptide was similar to a fragment,-P-YS--,located on N-terminal of MDRV-σC. It was thus postulated that the mimic antigen epitope of MDRV-σC was a conformational epitope with a discontinuous amino acid fragment. From the Genbank,this conformational epitope was also found in the peptide sequence of Pre-B cell colony-enhancing factor (PBEF).It appeared that using the phage-displayed peptide library to analyze structure of antigen epitopes could be a useful means.The results obtained from this study provided valuable information for our further study of the conformation and function of the MDRV proteins.